Skip to main content

Table 3 Sequence, annealing temperature and product size of primers used for qPCR. *F = forward primer; R = reverse primer; product size in base pairs

From: Ovarian activation delays in peripubertal ewe lambs infected with Haemonchus contortus can be avoided by supplementing protein in their diets

Gene symbol Accession no. Species Primer sequence 5′ - 3’ Annealing temperature(°C) Product size (bp)
INHBA NM_001009458.1 Sheep (Ovis aries) F: GGACGGAGGGCAGAAATGAA 63.7 80
    R:TTCCTGGCTGTGCCTGATTC   
HSD17B1 XM_027974501.1 Sheep (Ovis aries) F: CTTCTACCGCTACTGTCGCC 60 82
    R:GAGGAAGACCTCGACCACCT   
C7 XM_004017017.4 Sheep (Ovis aries) F:TGCCTAAATGTCAGCCCTGG 62.6 84
    R:CATGCAAGGAGGACCCACAT   
FST XM_012096672.3 Sheep (Ovis aries) F:GGATCTTGCAACTCCATTTCG 61.9 119
    R:AACACTGAACATTGGTGGAGG   
RABEP1 XM_015098590.2 Sheep (Ovis aries) F:GCTCAGTTATCAAATGAGGAGGAAC 61.3 87
    R:CCCGGATGGCAACAGTAAGT   
KDM5B XM_027976024.1 Sheep (Ovis aries) F:CTGCACTGTTGATTGGCTGC 63 98
    R:TGCAGATCATCTCGTCGTGG   
RPL7A XM_027966154.1 Sheep (Ovis aries) F:CAGCCTTTCAAGATGCCGAAG 62.5 113
    R:TTCTCGAACAGGGGGTTGAC