Skip to main content

Table 1 Primers used in the present study

From: Molecular characterization and immune functional analysis of IRF2 in common carp (Cyprinus carpio L.): different regulatory role in the IFN and NF-κB signalling pathway

Name of primer Sequence(5′-3′) GenBank accession No.
CcIRF2-F CAGATTCCGTGGATGCATG  
CcIRF2-R GTCTTCATGATGACGCTGG  
CcIRF2 RT-F TGGAGCAGAGAGCGATACAGACAG  
CcIRF2 RT-R GCAGTGCCATCCTCACCTTCTTG  
CcIRF2 ORF-F CCCAAGCTTATGCCGGTGGAGAGAATGCGT  
CcIRF2 ORF-R TCCCCGCGGGCAAGTCTTGACGGAGGATTTGG  
CcS11-F CCGTGGGTGACATCGTTACA AB012087
CcS11-R TCAGGACATTGAACCTCACTGTCT  
EPC-IFN-F CGCTAAGGTGGAGGACCAGGTTA FN178457
EPC-IFN-R TTAGGTTCCATTGTGCTGCGTTCA  
EPC-PKR-F TGGAGACTTCGGCCTCGTGACT KM099176
EPC-PKR-R TCGCTTGCTCCGGGCTCATGTA  
EPC-Viperin-F AAGACTTCCTGGACCGCCATAAGA KM099177
EPC-Viperin-R CCTCTCGGCAATCCAAGAAGCG  
EPC-ISG15-F ACAGTCGGTGAACTCAAGCAAGTC KM099174
EPC-ISG15-R CGTAACTGCTGAGGCTTCTGGAAT  
EPC-IRF3-F CGTGTCCACCACATGCTGAAGG KJ027520
EPC-IRF3-R ATCCAGAATCCTCCACCAGCTTGT  
EPC-β-actin-F GCCGTGACCTGACTGACTACCT KF844250
EPC-β-actin-R GCCACATAGCAGAGCTTCTCCTTG