Skip to main content

Table 3 List of the primers used with their details and references

From: First isolation of atypical enteropathogenic Escherichia coli from geese (Anser anser domestica) and first description of atypical EPEC from turkeys and pigeons in Hungary

Gene Primer name and its sequence (5’-3’) Reference
eae B52: AGGCTTCGTCACAGTTG [33]
B53: CCATCGTCACCAGAGGA  
stx 1 B54: AGAGCGATGTTACGGTTTG [33]
B55: TTGCCCCCAGAGTGGATG
stx 2 B56: TGGGTTTTTCTTCGGTATC [33]
B57: GACATTCTGGTTGACTCTCTT
sta STa-F: TTTATTTCTGTATTGTCTTT [34]
STa-R: ATTACAACACAGTTCACAG
lt1 LT1-F: AGCAGGTTTCCCACCGGATCACCA [34]
LT1-R: GTGCTCAGATTCTGGGTCTC
ipaH IPAH III: GTTCCTTGACCGCCTTTCCGATACCGTC [35]
IPAH IV: GCCGGTCAGCCACCCTCTGAGAGTAC
aggR aggR-3: CATCTCTTTGATAAGTCCTTCTCG [36]
aggRks-1: GTATACACAAAAGAAGGAAGC
bfpA EP1: AATGGTGCTTGCGCTTGCTGC [37]
EP2: GCCGCTTTATCCAACCTGGTA
eaf Eaf1: CAGGGTAAAAGAAAGATGATAA [38]
Eaf2: TATGGGGACCATGTATTATCA
chuA ChuA.1b: ATGGTACCGGACGAACCAAC [39]
chuA.2: TGCCGCCAGTACCAAAGACA
YjaA yjaA.1b: CAAACGTGAAGTGTCAGGAG [39]
yjaA.2b: AATGCGTTCCTCAACCTGTG
TspE4C2 TspE4C2.1b: CACTATTCGTAAGGTCATCC [39]
TspE4C2.2b: AGTTTATCGCTGCGGGTCGC
arpA AceK.f: AACGCTATTCGCCAGCTTGC [39]
ArpA1.r: TCTCCCCATACCGTACGCTA
tir TirY474-F: CATATTTATGATGAGGTCGCTC [40]
TirS478-F: TCTGTTCAGAATATGGGGAATA
Tir-R: TAAAAGTTCAGATCTTGATGACAT