Skip to main content

Table 2 Sequence of genes and primers used for relative quantification by real-time PCR (qPCR) in hen’s uterine and liver tissues

From: Effect of organic and inorganic dietary selenium supplementation on gene expression in oviduct tissues and Selenoproteins gene expression in Lohman Brown-classic laying hens

Name of Target gene Nucleotide sequence of primers (5′ → 3′) Fragment Size (bp) Reference (s)
Oviduct genes
 Ovocalyxin-32 (OCX32) F: GGACAGCACTGCACTACATCAA 514 [38]
R: GGAATTTCGTGGAGCAAGACAA   
 Ovocalyxin-36 (OCX-36) F: TTGGAATGGTCGTCTTCTGTGG 121 [39]
R: CGGTCTGAATGATGGCATCG   
 Ovocleidin-17 (OC-17) F: CGTTCTGCCGCCGTTGGG 96 [40]
R: CCCGCGACGCGTTGAGGA   
 Ovocleidin-116 (OC-116) F: AAGAGCCAACATCCAAGTGGGTGAGAAT 424 [41]
R: CAGTGACCACATGGCTCCCTTTCCT   
Hepatic selenoproteins
 Glutathione peroxidase1 F: GCGACTTCCTGCAGCTCAACGA 99 [10, 11]
R: CGTTCTCCTGGTGCCCGAAT  
 Glutathione peroxidase4 F: CGGTGAATTACACTCAGCTCGT 123
R: CTTTGATCTGCGCGTCGTCC  
 Iodothyronine deiodinase1 F: AAGCTGCACCTGACCTTCATT 138
R: TTGTTTCTGAAGGCCCATCCA  
 Iodothyronine deiodinase4 F: CAGTGTAATCCACATAGCCA 137
R: CTGAGCCAAAATTAACCACC  
 Selenoprotein W1 F: CTCCGCGTCACCGTGCTCT 155
R: CTGCCCACCGTCACCTCGAAC  
 Thioredoxin reductase1. F: ACTGGATGACTATGACCGAA 103
R: TATGCATTCTCATACGTGAC  
Housekeeping
 Glyceraldehyde-3-phosphate dehydrogenase F: AATGAGAGGTTCAGGTGCCC 150 [10, 11]
R: ACCAGACAGCACTGTGTTGG  
 β-actin8 F: ACACACGGACACTTCAAGGG 128
R: TACTCAGCACCTGCATCTGC  
 TATA-Box Binding Protein F: TAGCCCGATGATGCCGTAT 147 [42, 43]
R: GTTCCCTGTGTCGCTTGC