Skip to main content

Table 7 Primers used for qRT-PCR analysis

From: The impact of vitamin E and/or selenium dietary supplementation on growth parameters and expression levels of the growth-related genes in broilers

Gene Primer Reference Annealing temperature
B-actin F: ACCTGAGCGCAAGTACTCTGTCT
R: CATCGTACTCCTGCTTGCTGAT
Xie et al. [47] 60 °C
GHR F: AACACAGATACCCAACAGCC
R: AGAAGTCAGTGTTTGTCAGGG
El-Naggar et al. [48] 60 °C
IGF F: CACCTAAATCTGCACGCT
R: CTTGTGGATGGCATGATCT
El-Naggar et al. [48] 60 °C
  1. GHR growth hormone receptor and IGF Insulin like growth factor