Skip to main content

Table 1 Primers and probe used in cloning and Quantitative RT-PCR

From: Efficacy of a live attenuated highly pathogenic PRRSV vaccine against a NADC30-like strain challenge: implications for ADE of PRRSV

Name Sequence (5′-3′)
JXA1-R (clone) F: TGTCCTGGAAGAATATGGG
R: GCAATCGGATCTGACCTT
JXA1-R (RT-PCR) F: AACTAACCAACACCCAGGCG
R: CGGGTAGCTTTTGACCCAAG
JXA1-R Probe FAM-CGACTTCAGAAATGATGGCCTGGGCGG-BHQ-1
HNhx (clone) F: GGTGGTTCCTTCCATTCTCC
R: CTCTGCGGCAACGTCAAA
HNhx (RT-PCR) F: GCTGAAGCCGTCACCGATA
R: TTCATTCCTCCCACCTGCTG
HNhx-Probe CY5-CGTCAACCCCTGTGCCCGCACCAC--BHQ-2
  1. F Forward primers, R Reverse primer