Skip to main content

Table 1 Primer sequences used for amplification of qPCR

From: Angelica polysaccharide attenuates LPS-induced inflammation response of primary dairy cow claw dermal cells via NF-κB and MAPK signaling pathways

Accession No. Genesa Sense Antisense Product size(bp)
NM_174198.6 TLR4 AGCTTCAACCGTATCATGGCCTCT ACTAAGCACTGGCATGTCCTCCAT 166
NM_001014382.2 MyD88 AAGTACAAGCCAATGAAGAAAGAG GAGGCGAGTCCAGAACCAG 102
NM_174006.2 CCL2 CGCTCAGCCAGATGCAATTA GACCCATTTCTGCTTGGGGT 184
NM_174263.2 CCL20 TTGATGTCAGTGCTATTGCT ACCCACTTCTTCTTTGGATC 209
NM_174299.3 CXCL2 ACCGAAGTCATAGCCACTCTC TCCAGATGGCCTTAGGAGGT 218
NM_173925.2 CXCL8 AAACACATTCCACACCTTTC TCTTCACAAATACCTGCACA 171
NM_001046551 CXCL10 CTCGAACACGGAAAGAGGCA TCCACGGACAATTAGGGCTT 117
NM_001034034.2 GAPDH CACCCTCAAGATTGTCAGCA GGTCATAAGTCCCTCCACGA 103
  1. aTLR4, toll-like receptor 4, MyD88, myeloid differentiation factor 88, GAPDH, Glyceraldehyde 3-phosphate dehydrogenase