Skip to main content

Table 3 Primer sequences

From: Viability, yield and expansion capability of feline MSCs obtained from subcutaneous and reproductive organ adipose depots

Primer Amplicon Size (bp) Sequence
Gapdh 234 Forward: GCGTGAACCACGAGAAGTAT
Reverse: CAGTAGAAGCAGGGATGATGTT
CD73 112 Forward: CAACATGGGCAACCTGATTTG
Reverse: CCGAATGCCACCTCCATTTA
CD90 130 Forward: CCTCTCTGCCTGATGAAACTAA
Reverse: CAGAGTTCTGGAAGCTCTTAGG
CD105 138 Forward: CCTTTGGCGCCTTCCTTAT
Reverse: GGTTGGTGCTACTGCTTTCT
CD34 199 Forward: ACCATCAAGGGAGAAATCA
Reverse: GTCAGTTCCTCCCCATTAC
Gata4 251 Forward: CCTCTTGCAATGCGGAAAGA
Reverse: GACATCGCACTGACTGAGAAC
Gata6 246 Forward: CTCGACCGCTTGCTATGAAA
Reverse: GCTCGCTGTTCTCAGGATTAG
Sox2 280 Forward: GCAGTACAACTCCATGACCA
Reverse: GTAGTGCTGGGACATGTGAA
Sox17 322 Forward: CCGCACGGAATTTGAACAGTA
Reverse: CCGTTCAAGTGGCAGACAAA
Pdx1 343 Forward: GCTACGCAGCTCTACAAGGA
Reverse: TAGACTTCATCCACGGGAAAGG