Skip to main content

Table 3 Primers used for sequencing of ORF5

From: Analysis of ORF5 sequences of Porcine Reproductive and Respiratory Syndrome virus (PRRSV) circulating within swine farms in Costa Rica

Name Sequency AB811788 Amplicon size
PRRS OUT 1 F 5’- GTACGGCGATAGGGACACC-3´ 13416  
PRRS OUT 2 R 5’- CCAGAATGTACTTGCGGCC-3 14672 1256 pb
PRRS P420 F 5´- CCATTCTGTTGGCAATTTGA -3´ 13731  
PRRS P620 R 5´- GGCATATATCATCACTGGCG-3´ 14440 716 pb