Skip to main content

Table 1 Genus and species-specific primers, thermocyclic conditions and amplicon size of the various genes used for the detection and amplification of cattle blood pathogens. Thermocyclic conditions include initial denaturing (ID), denaturing (D), annealing (A), extension (E), and final extension (FE)

From: Molecular detection of Theileria species, Anaplasma species, Candidatus Mycoplasma haemobos, Trypanosoma evansi and first evidence of Theileria sinensis-associated bovine anaemia in crossbred Kedah-Kelantan x Brahman cattle

Blood Pathogens Gene Primer Sequences (5′-3′) Forward (F) and Reverse (R) Thermocyclic conditions Base pair (bp) References
Anaplasma species 16SrRNA EHR16SD - GGTACCYACAGAAGAAGTCC
EHR 16SR -TAGCACTCATCGTTTACAGC
ID: 95 °C /5mins
D: 95 °C /30s
A: 55 °C /30s
E: 72 °C /90s
No of cycles: 40
FE: 72 °C /5mins
345 [47]
Theileria species 18SrRNA F-ACCTGGTTGATCCTGCCAG
R-GATCCTTCGCAGGTTCACCTAC
ID: 94 °C /5mins
D: 94 °C /30s
A: 60 °C /30s
E: 72 °C /1 min
No of cycles: 40
FE: 72 °C /5mins
1750 [48]
Mycoplasma species 16SrRNA F-GGGAGCAAACAGGATTAGATACCCT
R-TGCACCATCTGTCACTCTGTTAACCTC
ID: 94 °C /5mins
D: 94 °C /30s
A: 55 °C /30s
E: 72 °C /1 min50secs
No of cycles: 40
FE: 72 °C/10 mins
280 [49]
Anaplasma marginale MSP4 F- CATCTCCCATGAGTCACGAAGTGGC
R-GCTGAACAGGAATCTTGCTCCAAG
ID: 95 °C /5mins
D: 95 °C /1 min
A: 65 °C /2mins
E: 72 °C /1 min
No of cycles: 40
FE:72 °C/10 min
761 [50]
Theileria orientalis MPSP F- CTTTGCCTAGGATACTTCCT
R- ACGGCAAGTGGTGAGAACT
ID: 94 °C /4mins
D: 94 °C /1 min
A: 63 °C /1 min
E: 72 °C /1 min
No of cycles: 40
FE:72 °C /7mins
776 [51]
Theileria sinensis MPSP Tsin F- CACTGCTATGTTGTCCAAGAGATATT
Tsin R-AATGCGCCTAAAGATAGTAGAAAAC
ID: 94 °C /3mins
D: 94 °C /1 min
A: 56 °C /1 min
E: 72 °C /1 min
No of cycles: 40
FE:72 °C /7mins
887 [52]
Trypanosoma evansi RoTaT 1.2 VSG F-GCG GGG TGT TTA AAG CAA TA
R-ATT AGT GCT GCG TGT GTT CG
ID: 94 °C/4mins
D: 94 °C /1 min
A: 59 °C /1 min
E: 72 °C /1 min
No of cycles:40
FE: 72 °C/5mins
205 [53]
Candidatus Mycoplasma haemobos 16SrRNA F-GAGTTAGTTATTAAAGCTTTAT
R-ATTCATGAGGTACTATCAGTTG
ID: 94 °C /5mins
D: 94 °C /30s
A: 55 °C /30s
E: 72 °C /30s
No of cycles: 40
FE:72 °C /7mins
279 [49]