Skip to main content

Table 3 Primer sequences, product sizes, and PCR conditions in this study

From: Prevalence, virulence factor and antimicrobial resistance analysis of Salmonella Enteritidis from poultry and egg samples in Iran

Target genes Primer sequences
(5′ to 3′)
Product size (bp) PCR conditions References
Salmonella genus specific gene
invA F: AAACGTTGAAAAACTGAGGA
R: TCGTCATTCCATTACCTACC
199 -Initial denaturation (95 °C for 10 min)
− 30 cycles of:
- Denaturation (94 °C for 60 s)
- Annealing (62 °C for 90 s)
- Extension (72 °C for 90 s)
- Final extension (72 °C for 10 min)
[29]
S. Enteritidis serovar specific gene  
Sdf F: AAATGTGTTTTATCTGATGCAAGAGG
R: GTTCGTTCTTCTGGTACTTACGATGAC
299 [30]
Virulence genes
pagC F: CGCCTTTTCCGTGGGGTATGC
R: GAAGCCGTTTATTTTTGTAGAGGAGATGTT
454 -Initial denaturation (95 °C for 10 min)
− 35 cycles of:
- Denaturation (94 °C for 40 s)
- Annealing (62 °C for 30 s)
- Extension (72 °C for 40 s)
- Final extension (72 °C for 10 min)
[21]
cdtB F: ACAACTGTCGCATCTCGCCCCGTCATT
R: CAATTTGCGTGGGTTCTGTAGGTGCGAGT
268
msgA F: GCCAGGCGCACGCGAAATCATCC
R: GCGACCAGCCACATATCAGCCTCTTCAAAC
189
spaN F: AAAAGCCGTGGAATCCGTTAGTGAAGT
R: CAGCGCTGGGGATTACCGTTTTG
504
tolC F: TACCCAGGCGCAAAAAGAGGCTATC
R: CCGCGTTATCCAGGTTGTTGC
161
lpfC F: GCCCCGCCTGAAGCCTGTGTTGC
R: AGGTCGCCGCTGTTTGAGGTTGGATA
641
Virulence plasmid-associated gene
spvC F: ACTCCTTGCACAACCAAATGCGGA
R: TCTCTTCTGCATTTCGCCACCATCA
571 - Initial denaturation (94 °C for 5 min)
−35 cycles of:
- Denaturation (94 °C for 30 s)
- Annealing (57 °C for 40 s)
- Extension (72 °C for 30 s)
- Final extension (72 °C for 10 min)
[31]