Skip to main content

Table 3 Chicken primers used for real-time PCR

From: The stimulation and inhibition of beta-2 adrenergic receptor on the inflammatory responses of ovary and immune system in the aged laying hens

Gene Accession No. primers sequences (5′ → 3′) Orientation
β2ADR 1 XM_004950587 GACGCCGGAACGCTGAG Forward
GAAGACAGTGACCAGCACGA Reverse
COX-1 2 XM_425326 TCAGGTGGTTCTGGGACATCA Forward
TGTAGCCGTACTGGGAGTTGAA Reverse
COX-2 3 XM_422297 CTGCTCCCTCCCATGTCAGA Forward
CACGTGAAGAATTCCGGTGTT Reverse
IL-1β 4 AB559570 CTTCCTCCAGCCAGAAAGT Forward
CAGCTTGTAGCCCTTGAT Reverse
IL-6 5 AB559572 CAACCTCAACCTGCCCAA Forward
GGAGAGCTTCCTCAGGCATT Reverse
IL-10 6 AB559574 CACAACTTCTTCACCTGCGAG Forward
CATGGCTTTGTAGATCCCGTTC Reverse
TNF-α 7 AY765397 TGTGTATGTGCAGCAACCCGTAGT Forward
GGCATTGCAATTTGGACAGAAGT Reverse
β-Actin 8 L08165 CATCACCATTGGCAATGAGAGG Forward
GCAAGCAGGAGTACGATGAATC Reverse
  1. 1) Beta-2 adrenergic receptor, 2) Cyclooxygenases-1, 3) Cyclooxygenases-2, 4) Interleukin-1β, 5) Interleukin − 6, 6) Interleukin − 10, and 7) Tumor necrosis factor-α. 8) β2ADR, COX-1, COX-2, IL-1β, IL-6, IL-10, and TNF-α mRNA data that are normalized by β-actin