Skip to main content

Table 1 Primers for PCR, sequencing or RT-PCR

From: Identification of four insertion sites for foreign genes in a pseudorabies virus vector

Primer Sequence (5’- 3’)
S-F ATGAAGTCTTTAACCTACTTCTGG
S-R TCACTGCACGTGGACCTTTT
Kan ins S F CCGGAATTCAAACGCCATGTACTTTCCCACCATTGACGTCAATGGGCTAGGATGACGACGATAAGTAGGGATAAC
Kan ins S R GGCGAATTCGGGTAATGCCAGTGTTACAACCA
PRV ins S cas UL11-10 F TCGCGGGCGTACTGACTGCAATAAACCCGTTTGTCATACTCTAGTGGATCCCCCAACTCC
PRV ins S cas UL11-10 R CGGCGACGAGGTCGTGTACGAGAACCTCGGCTTTGAATAATTGTCGACTCTAGAGGATCCG
PRV ins S cas UL35-36 F TGCCCTCGCCCCTCGCCCTAGCCCCGCGCGATCAATAAAGCTAGTGGATCCCCCAACTCC
PRV ins S cas UL35-36 R GTGGACCTATTTCAGGTCCGCCTGATTCTTGGTTAATAAATTGTCGACTCTAGAGGATCCG
PRV ins S cas UL46-27 F TGCCCCCCTGTGTGGAAATAAAGTTTTTTTCTAATTCTGTCTAGTGGATCCCCCAACTCC
PRV ins S cas UL46-27 R CTACCAGCGCCTCGAGAACGAGGACCCCGACGCCCCCTAGTTGTCGACTCTAGAGGATCCG
PRV ins S cas US2-1 F CAACGGACGCGAGCGCGCCCCGCGATGTACCATCTCCTAGCTAGTGGATCCCCCAACTCC
PRV ins S cas US2-1 R CTCTGTTGTGCCCTCAATAAACACGGCGGCCCGCCGCTCGTTGTCGACTCTAGAGGATCCG
PRV BAC H1 F GTACCCGTACACCGAGTCGT
PRV BAC H2 R TTGTGGACCCGCGCGAACAT
S cas check F CTAGTGGATCCCCCAACTCC
S cas check R TTGTCGACTCTAGAGGATCC
PRV ΔgE check F AGCCCCGGGAAGATAGCCAT
PRV ΔgE check R ATCGCGGAACCAGACGTCGAAG
S exp F CGGTAACACTAATGCTACTGCGCG
S exp R CGATCATTATCCCATGTTATGCCG
Beta actin F AGAGCGCAAGTACTCCGTGT
Beta actin R ACATCTGCTGGAAGGTGGAC