Skip to main content

Table 1 Primers used for gene expression analysis by RT-qPCR

From: “Limiting access to iron decreases infection of Atlantic salmon SHK-1 cells with bacterium Piscirickettsia salmonis

Gene name or symbol Accession Function related Primers (5′- > 3′) Reference
HEPCIDIN-1 BT125319 Iron regulator, Antimicrobial F:ATGAATCTGCCGATGCATTTC This study
R: AATGGCTTTAGTGCTGGCAG
CATHELICIDIN-1 (CATH) AY360357 Antimicrobial F: AGACTGGCAACACCCTCAAC [68, 69]
R: TTGCCTCTTCTTGTCCGAAT
iNOS AF088999 Antimicrobial F: GGAGAGCCTTCTGGTTG [69]
R: ACCTTAACTTGTTCCTGAGATAC
TNF-α NM_001123589 Immune signalling F: AGGTTGGCTATGGAGGCTGT [63]
R: TCTGCTTCAATGTATGGTGGG
IL-1β NM_001123582 Immune signalling F: ATCACCATGCGTCACATTGC [63]
R: GTCCTTGAACTCGGTTCCCA
IL-8 NM_001140710 Immune signalling F: GGCCCTCCTGACCATTACT [63]
R: ATGAGTCTACCAATTCGTCTGC
IFN-γ AY795563 Immune signalling F: CTAAAGAAGGACAACCGCAG [63]
R: CACCGTTAGAGGGAGAAATG
GSK-3 BT049486.1 Immune signalling F: AAAAGAAGTGGACGCGTTGG This study
R: GTTACTACTGCTGCAGTTGCTG
ELF-1α AF321836 Normalizer F: CTGGCACTTTCACTGCTCAAG This study
R: CAACAATAGCAGCGTCTCCA