Skip to main content

Table 6 Primer sequences used to amplify two different regions of N gene

From: Development of TaqMan-based real-time RT-PCR assay based on N gene for the quantitative detection of feline morbillivirus

Region Primer Sequence (5′-3′) Product size (bp) Source
Middle region FN-2F GTTAGCTTAGGATTTGAGAACCC 680 bp [12]
FN-2R CACCATCTCTTGACCAAGTCT
End region FN-3F GCTATGGAGTTATGCCATGGG 637 bp
FN-3R GTTGTGAACCTTGAGGTCCTAAG