Skip to main content

Table 3 Primers used in this study

From: Molecular detection and genetic diversity of Rickettsia spp. in pet dogs and their infesting ticks in Harbin, northeastern China

Gene Primer Sequence (5’→3’) Amplicon (bp) Reference
Tick rrs 16SF F: GTATTTTGACTATACAAAGGTATTG 300 [55]
  16SR R: TATTACGCTGTTATCCCTAGAGTATT   
gltA Ric-CS409d F: CCTATGGCTATTATGCTTGC 720 [57]
  Ric-CS535d F: GCAATGTCTTATAAATATTC   
  Ric-CS1258n R: ATTGCAAAAAGTACAGTGAACA   
  Ric-CS2d F: ATGACCAATGAAAATAATAAT 1200 [7]
  Ric-CSEndr R: CTTATACTCTCTATGTACA   
17-kDa Rr17k.1p F: TTTACAAAATTCTAAAAACCAT 450 [56]
  Rr17k.90p F: GCTCTTGCAACTTCTATGTT   
  Rr17k.539n R: TCAATTCACAACTTGCCATT   
Rickettsial rrs Ric-16SF F: GAACGAACGCTATCGGTATGC 1300 This study
  Ric-16SR1 R: AATTTTACCGTGGTTGGCTGC   
  Ric-16SR2 R: TGCCTCTTGCGTTAGCTCAC   
groEL Ric-ESL-F1 F: GGTAAATGGGCAGGYACCGAA 1500 This study
  Ric-ESL-R1 R: GAAGCAACRGAAGCAGCATCTTG   
  Ric-ESL-F2 F: ATCGTTATGAAAGAAAGCGAYG 1500 This study
  Ric-ESL-R2 R: AGWGCAGTACGCACTACTTTAGC   
ompA Rr190k.71p F: TGGCGAATATTTCTCCAAAA 530 [56]
  Rr190k.602n R: AGTGCAGCATTCGCTCCCCCT   
  Rr190k.720n R: TGCATTTGTATTACCTATTGT   
  1. F Forward primer. R Reverse primer. Y = C or T. W = A or T