Skip to main content

Table 2 Primers and MGB probes used in qPCR in this study and targeting genes they used to detect

From: G1-like M and PB2 genes are preferentially incorporated into H7N9 progeny virions during genetic reassortment

Primer /probe Sequence(5′ to 3′) Gene detected
M-F948 TGCCTGAGTCTATGAGGGAAG GD15-M, SH14-M, CZ73-M, AH320-M
M-R1012 ACCATCGTCAACATCCACAG GD15-M, SH14-M, CZ73-M, AH320-M
SH14-Mprobe974 FAM-CGGCAGGAGCAACAGAG-MGB SH14-M
GD15-Mprobe974 VIC-CAGCATTCTGCCGTTCCT-MGB GD15-M
Mprobe975–17 VIC-AGCATTCTGCTGTTCCT-MGB CZ73-M, AH320-M
PB2-F650 TTGCTCCTTTAATGGTGGC GD15-PB2, SH14-PB2, CZ73-PB2, AH320-PB2
PB2-R772 AGGTCCCTTGAGTCAAATGC GD15-PB2, SH14-PB2, CZ73-PB2, AH320-PB2
SH14-PB2probe713 FAM-CGGTAGCAGGTGGAACAA-MGB SH14-PB2
GD15-PB2probe713 VIC-CAGTGGCTGGAGGGACA-MGB GD15-PB2
PB2probe974RC VIC-TTGTCCCTCCAGCTACTGG-MGB CZ73-PB2, AH320-PB2