Skip to main content

Table 3 Primers sequences used in simplex and multiplex PCR assays for β-lactams, quinolones, and aminoglycosides and tetracycline resistance genes

From: Antibiotic resistance profiles in cultivable microbiota isolated from some romanian natural fishery lakes included in Natura 2000 network

The gene Primer Nucleotide sequence Amplification size and Tm References
bla OXA−48 OXA-F
OXA-R
GCGTGGTTAAGGATGAACAC
CATCAAGTTCAACCCAACCG
438
52 °C
[53]
bla NDM NDM-F
NDM-R
GGTTTGGCGATCTGGTTTTC
CGGAATGGCTCATCACGATC
621
52 °C
bla TEM TEM-F
TEM-R
ATGAGTTTTCAACATTTTCG
TTACCAATGCTTAATCAG TG
861
59 °C
[54]
bla SHV SHV-F
SHV-R
GCCCTCACTCAAGGATGTAT
TTAGCGTTGCCAGTGCTCGA
888
58 °C
[55]
bla CTX−M CTX-M-F
CTX-M-R
CGCTGTTGTTAGGAAGTGTG
GGCTGGGTGAAGTAAGTGAC
730
59 °C
[56]
bla OXA−23 OXA-23-F
OXA-23-R
ATGAGTTATCTATTTTTGTC
TGTCAAGCTCTTAAATAATA
501
52 °C
[57]
bla OXA−24 OXA24/40-F
OXA24/40-R
GCAGAAAGAAGTAAARCGGGT
CCAACCWGTCAACCAACCTA
270
52 °C
[58]
bla OXA−51 OXA-51-F
OXA-51-R
TAATGCTTTGATCGGCCTTG
TGGATTGCACTTCATCTTGG
353
52 °C
[57]
bla OXA−58 OXA-58-F
OXA-58-R
AAGTATTGGGGCTTGTGCTG
CCCCTCTGCGCTCTACATAC-
599
58 °C
[57]
bla OXA−143 OXA-143-F
OXA-143-R
TGGATTGCACTTCATCTTGG
TGGCACTTTCAGCAGTTCCT
180
58 °C
[59]
bla OXA−235 OXA-235-F
OXA-235-R
TTGTTGCCTTTACTTAGTTGC
CAAAATTTTAAGACGGATCG
700
58 °C
[59]
bla IMP IMP-F
IMP-R
GGAATAGAGTGGCTTAAYTCTC
GGTTTAAYAAAACAACCACC
232
52 °C
[58]
blaVIM−2 VIM − 2-F
VIM-2-R
GATGGTGTTTGGTCGCATA
CGAATGCGCAGCACCAG
800
52 °C
[58]
QnrA QnrAm-F
QnrAm-R
AGA GGA TTT CTC ACG CCA GG
TGC CAG GCA CAG ATC TTG AC
60 °C
580
This study
QnrB QnrBm-F
QnrBm-R
GGM ATH GAA ATT CGC CAC TG (M = A or C, H = A or C or T)
GGM ATH GAA ATT CGC CAC TG (Y = C or T)
60 °C
264
QnrS QnrS-F
QnrS-R
GCAAGTTCATTGAACAGGGT TCTAAACCGTCGAGTTCGGCG 428
60 °C
 
aac3Ia aac-3-IaF
aac3IAR
ATGGGCATCATTCGCACA
TCTCGGCTTGAACGAATTGT
59 °C DQ370505
tetA tetA-F
tetA-R
GCRGCGATCTGGTTCACTCG
AGTCGACAGYRGCGCCGGC
61 °C
164
[60]
tetB tetB-F
tetB-R
TACGTGAATTTATTGCTTCGG
ATACAGCATCCAAAGCGCAC
61 °C
206
tetC tetC-F
tetC-R
GCGGGATATCGTCCATTCCG
GCGTAGAGGATCCACAGGACG
68 °C
207
tetD tetD-F
tetD-R
GGAATATCTCCCGGAAGCGG
CACATTGGACAGTGCCAGCAG
68 °C
187
tetM tetM-F
tetM-R
ACAGAAAGCTTATTATATAAC
TGGCGT GTCTATGATGTTCAC
55 °C
171
[61]
Sul1 Sul1-F
Sul1-R
CGGCGTGGGCTACCTGAACG
GCCGATCGCGTGAAGTTCCG
432
69 °C
[61]
Sul2 Sul2-F
Sul2-R
GCGCTCAAG GCAGATGGCATT
GCGTTTGATACCGGCACCCGT
293
69 °C
Int Int-F
Int-R
ATGGCCGAGCAGATCCTGCACG
GCCACTGCGCCGTTACCACCGC
899
60 °C
dfrA1-
aadA1
dfrA1-
aadA1-F
dfrA1-
aadA1-R
AGCATTACCCAACCGAAAGT
TGTCAGCAAGATAGCCAGAT
818
60 °C