Table 3 The positions of designed primers and probe within hexon gene in the genome of FAdV-2/D KT862805(ANJ02325), FAdV-3/D KT862807 (ANJ02399) and FAdV-11/D KC750784 (AGK29904) used in Real - time PCR
Gene | Name | Sequence | Genome Location | Amplicon size |
|---|---|---|---|---|
hexon | FAdV JSN-F | 5’AATGTCACNACCGARAAGGC 3’ | 20,666–20,685 | 93 |
hexon | FAdV JSN-R | 5’CBGCBTRCATGTACTGGTA 3’ | 20,759–20,739 | 93 |
hexon | JSN-FAdV probe | 5′ AATCCCTACTCGAACACCCC 3’ | 20,739–20,760 | – |