Skip to main content

Table 3 The positions of designed primers and probe within hexon gene in the genome of FAdV-2/D KT862805(ANJ02325), FAdV-3/D KT862807 (ANJ02399) and FAdV-11/D KC750784 (AGK29904) used in Real - time PCR

From: Detection of fowl adenovirus D strains in wild birds in Poland by Loop-Mediated Isothermal Amplification (LAMP)

Gene Name Sequence Genome Location Amplicon size
hexon FAdV JSN-F 5’AATGTCACNACCGARAAGGC 3’ 20,666–20,685 93
hexon FAdV JSN-R 5’CBGCBTRCATGTACTGGTA 3’ 20,759–20,739 93
hexon JSN-FAdV probe 5′ AATCCCTACTCGAACACCCC 3’ 20,739–20,760
  1. NRB - degenerated bases