Skip to main content

Table 2 The positions of designed primer sequences within the hexon gene in the genome of FAdV-2/D KT862805 (ANJ02325), FAdV-3/D KT862807 (ANJ02399), and FAdV-11/D KC750784 (AGK29904) used in LAMP loop-mediated isothermal amplification

From: Detection of fowl adenovirus D strains in wild birds in Poland by Loop-Mediated Isothermal Amplification (LAMP)

Gene Name Sequence Genome Location No. of bp.
hexon F3 JSN 5’ACAACTACCTGTGGACCGT 3’ 20,863–20,879 19
hexon B3 JSN 5′ CGTTCGGGTTGGTTCACC 3’ 21,041–21,059 18
hexon LF JSN 5′ GGATTCTGACCCAGGTCCGT 3’ 20,917–20,936 20
hexon LB JSN 5′ CGAGAACACKTACGTSTACAT 3′ 20,995–21,014 21
hexon FIP(F1c + F2)JSN 5’TGCTGTGCGAGTTGTTGGTGTATTTTTCATGTACATGGGCGAACTG 3’ 20,896–20,916/20,941–20,962 46
hexon BIP(B1c + B2)JSN 5’ACTTCGAGTTGGACCCCATGGATTTTATGTCGAACACGCCGTAGA 3’ 20,971–20,993/21,017–21,035 45