Skip to main content

Table 2 Primer sequences of RT-PCR

From: Effects of Lactobacillus plantarum on intestinal integrity and immune responses of egg-laying chickens infected with Clostridium perfringens under the free-range or the specific pathogen free environment

TargetPrimer sequence(5′-3′)Accession no.Product size (bp)
claudin-1F:TCCAAGCTCACCAAAGAGGGNM_001013611.2128
R:ACCGGTGACAGACTGGTTTC
TLR2F:TACAGATGCTACTGTGCCTGANM_001161650.1102
R:CACTTTCCAGTGCCCAAGAG
TLR4F:TTCCATGGCTTAACGTCGCTNM_001030693.182
R:AGTGTCCGATGGGTAGGTCA
OccludinF:TGTGTAAGGCCCACACCTCTNM_205128.192
R:TGCTCAGGGTACCATTCTGG
TNF-αF:GAGCGTTGACTTGGCTGTCXM_015294124.264
R:GAGCGTTGACTTGGCTGTC
IL-1βF:ACTGGGCATCAAGGGCTAXM_015297469.1131
R:GGTAGAAGATGAAGCGGGTC
MUC2F:TTCATGATGCCTGCTCTTGTCXM_42103593
R:CCTGAGCCTTGGTACATTCTTGT
β-actinF:TTGTCCACCGCAAATGCTTCNM_205518.1106
R:AGCCATGCCAATCTCGTCTT
  1. F was the upstream primer and R was the downstream primer