Skip to main content

Table 1 Primers used in this study

From: Incorporation of a truncated form of flagellin (TFlg) into porcine circovirus type 2 virus-like particles enhances immune responses in mice

GenesNamePrimer Sequence (5′-3′)
SUMOSUMO-FGCCATGGGTCATCACCATCATCATCACGTGGGTCGGACTCAGAAG
SUMO-RACCTCCAATCTGTTCGCGGTGAGCCTCAAT
Cap-FGAACAGATTGGAGGTATGACCTACCCGCGTCGTCG
CapCap-R1aCTCGAGTTACGGGTTCAGCGGAGGGTC
Cap-R2bCGGGTTCAGCGGAGGGTCCTTCA
TFlgTFlg-FACCCTCCGCTGAACCCGATCAACAACAACCTGCA
TFlg-RGCCGCTCGAGTTAGGAGTCGAGGTCAGACTGG
  1. a Primer used to clone the SUMO-Cap gene; b Primer used to clone the SUMO-Cap-TFlg gene; The underlined sequences represent the restriction enzyme site (NcoI and XhoI). The sequences in lowercase letters indicate the His6 tag. The sequences in bold indicate the stop codon