Skip to main content

Table 1 Sequences of primers used for qRT-PCR assays

From: Effect of gga-miR-155 on cell proliferation, apoptosis and invasion of Marek’s disease virus (MDV) transformed cell line MSB1 by targeting RORA

NamePrimer Sequences (5′ → 3′)
U6 RT primeGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCGATACA
U6 Forward primerCGCTTCGGCAGCACATATAC −3′
gga-miR-155 RT primeGTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCCTATC
gga-miR-155 Forward primerTGCGCTTAATGCTAATCGTGAT
gga-miR-155/U6 Reverse primerCCAGTGCAGGGTCCGAGGTATT
gga -β-actin Forward primerAGAAGGAGATCACAGCCCT
ggaβ-actin Reverse primerGGGTCCGGATTCATCGTACT
RORA Forward primerGACCTCTCCAACTGTGTCCA
RORA Reverse primerGCCACATTACCTCCCTTTGC