Skip to main content

Table 4 Control strains and primer pairs for the PCRs to detect nuc, mecA, mecC genes of S. aureus isolated from humans and animals in Mekelle, Ethiopia

From: Burden and antimicrobial resistance of S. aureus in dairy farms in Mekelle, Northern Ethiopia

Control strains
StrainTarget genes possessed
ATCC 29213nuc
ATCC43300mecA
LGA251mecC
Primers pairs
GenesNucleotide sequence (5′ → 3′)Amplified product size (bp)Refe.
nucFGCGATTGATGGTGATACGGTT267[53]
nucRAGCCAAGCCTTGACGAACTAAAGC
mecA P4TCCAGATTACAACTTCACCAGG162[54]
mecA P7CCACTTCATATCTTGTAACG
mecALGA251 MultiFPGAAAAAAAGGCTTAGAACGCCTC138
mecALGA251 MultiRPGAAGATCTTTTCCGTTTTCAGC
\