Skip to main content

Table 1 The list of primer sequences used for amplification of qPCR

From: Different effects of cortisol on pro-inflammatory gene expressions in LPS-, heat-killed E.coli-, or live E.coli-stimulated bovine endometrial epithelial cells

GenePrimer sequence (5′ → 3′)Accession number
β-ActinF: CATCACCATCGGCAATGAGCNM_173979.3
R: AGCACCGTGTTGGCGTAGAG 
TLR4F: GCTCTGCCTTCACTACAGGGACTNM_174198.6
R: CTGGGACACCACGACAATAACC 
IL1βF: TGATGACCCTAAACAGATGAAGAGCNM _174093.1
R: CCACGATGACCGACACCACCT 
IL6F: TGAAAGCAGCAAGGAGACACTNM_173923.2
R: TGATTGAACCCAGATTGGAAGC 
TNF-αF: CCCTTGTTCCTCACCCACNM_173966.2
R: CTCGGCATAGTCCAGGTAG 
IL8F: TTCCTCAGTAAAGATGCCAATGNM_173925.2
R: TGACAACCCTACACCAGACCCA