Skip to main content

Table 1 List of primers for real-time PCRa

From: Bacteriophages isolated from dairy farm mitigated Klebsiella pneumoniae-induced inflammation in bovine mammary epithelial cells cultured in vitro

Gene Primer Sequence (5’-3’) Size (bp)
GAPDH Forward
Reverse
TCACCAACTGGGACGACA
GCATACAGGGACAGCACA
206
TLR4 Forward
Reverse
GGACCCTTGCGTACAGGTTG
GGAAGCTGGAGAAGTTATGGC
155
NF-κB Forward
Reverse
GACCAAGGAGATGGACCTGA
ACGATTTTCAGGTTGGATGC
150
TNF-α Forward
Reverse
ATGTGTGTGGAGAGCGTCAA
GGGCCATACAGCTCCACAAA
145
IL-1β Forward
Reverse
ATGACTTCCAAGCTGGCTGTTG
TTGATAAATTTGGGGTGGAAAG
114
IL-6 Forward
Reverse
GCGCATCGGAGATGAATTGG
AGATGGTCACTGTCCAACCAC
296
IL-8 Forward
Reverse
AGTGCCTACGCACATGTCTTC
TGCGTCACACAGAAACTCGTC
151
Caspase-3 Forward
Reverse
GATGACATCGCCTGTCAGAA
AATTCTGTTGCCACCTTTCG
203
Caspase-9 Forward
Reverse
GTCACGGCTTTGATGGAGAT
CAGGCCTGGATGAAGAAGAG
224
Cyt-c Forward
Reverse
TGCTGGTGATGTTGAGAAGG
GTGTCCTCGTTCCAGGTGAT
327
  1. aAnnealing temperature for all primers was 60 °C
\