Skip to main content

Table 4 Primer and protocols used for amplification of some vector-borne pathogens

From: Evaluation of hematological alteration of vector‐borne pathogens in cats from Bangkok, Thailand

Organism Target gene Product size (bp) PCR primers (5’-3’) Reference
Babesia spp. 18S rRNA 422–440 F: GTTTCTGMCCCATCAGCTTGA
R: CAAGACAAAAGTCTGCTTGAAAC
[36]
Hepatozoon spp. 18S rRNA 666–800 F: ATACATGAGCAAAATCTCAAC
R: CTTATTATTCCATGCAG
[37]
Hemoplasmas 16S rRNA 595–618 F: ATACGGCCCATATTCCTACG
R: TGCTCCACCACTTGTTCA
[38]