Skip to main content

Table 5 All primers used in this study

From: Epidemiological investigation of porcine circovirus type 2 and its coinfection rate in Shandong province in China from 2015 to 2018

Primer name Sequences Annealing Temperature (℃) Product size(bp)
PCV2-F CCATATGAAATAAATTACTGAG 51 785
PCV2-R CAGCGCACTTCTTTCGTTTTCAG
CSFV-F TRACCAYGCAYATGWCAGAAGTACC 57 599
CSFV-R AGTCGACTTCCCTGGTTTCACTTG
PRRSV-F GCGGATCCATGCCAAATAACAAC 55 372
PRRSV-R AGCTCGAGTCATGCTGAGGGTGA
PRV-F TCCACTCGCAGCTCTTCT 57 632
PRV-R GCACGTCATCACGAAGGA
PEDV-F TTCCCGTTGATGAGGTGAT 51 552
PEDV-R AAGCATTGACTGAACGACC