Skip to main content

Table 2 Informations on primer sequences used for qRT-PCR analysis

From: Doxorubicin treatment modulates chemoresistance and affects the cell cycle in two canine mammary tumour cell lines

Gene Sequence (5′-3′) PCR bp AN Reference
P-gp For GCTTAACACCCGGCTCACAGAC 402 FJ617477.1 Pawlowski et al., 2013 [30]
Rev TAAGAAAGCGGCACCAATAGAAT
BCRP For TTAGACTCCAGCACAGCAAATG 189 DQ222459.1 Present study
Rev AACCCACTGACGCAAAGAAC
GAPDH For TGTCCCACCCCCAATGTATC 100 NM_001003142 Zannoni et al., 2020 [77]
Rev CTCCGATGCCTGCTTCACTACCT
Rpl32 For GGCACCAGTCAGACCGATATG 209 NM_001252169.1 Zannoni et al., 2020 [77]
Rev GCACATCAGCACTTCAAG
Sdha For CGCATAAGAGCCAAGAAC 194 XM_535807 Zannoni et al.; 2020 [77]
Rev CCTTCCGTAATGAGACAAC