Skip to main content

Table 1 Primers used in this study

From: Porcine interferon lambda 3 (IFN-λ3) shows potent anti-PRRSV activity in primary porcine alveolar macrophages (PAMs)

Genes Primer names Sequence (5′-3′) Product size (bp)
Mx1 Mx1-F CATCAACTTGGTGGTGGTC 200
Mx1-R CAATCATGTAGCCCTTCTTC
β-actin β-actin-F ATCGTGCGGGACATCAAG 179
β-actin-R GGAAGGAGGGCTGGAA
ISG15 ISG15-F TGAGGGACTGCATGATGGC 197
ISG15-R CAGGATGCTCAGTGGGTCT
IFITM3 IFITM3-F GCTTCCCAGCCCTTCTTC 142
IFITM3-R TCTCGCTTCGGATGTTGAT
OAS1 OAS1-F TCCGAACGCAGGTCAAGG 136
OAS1-R AAGACGACGAGGTCAGCA