Skip to main content

Table 3 Primers used for qPCR for determination of endometrial LPAR1–4 mRNA level at different stages of endometrosis

From: Lysophosphatidic acid as a regulator of endometrial connective tissue growth factor and prostaglandin secretion during estrous cycle and endometrosis in the mare

Gene name Primer sequence (5′ – 3′) Amplicon length (bp) Accession no. GenBank
SDHA GAGGAATGGTCTGGAATACTG 91 DQ402987.1
GCCTCTGCTCCATAAATCG
LPAR1 TTCAACTCTGCCATGAACC 85 XM_014735958
GCTGGCAGCAGAGGATCT
LPAR2 CTCAGCCGCTCCTACCTG 71 XM_023625558
TAGACAGCCACCATGAGCAG
LPAR3 TCGCAGCAGTGATCAAAAAC 122 XM_001917815
TGGGCCAGTGTTAAACATCA
LPAR4 GGCAATGCTACTGCCAATAA 104 XM_001501421
TTGGTTATCAGACCCAGGATG