Skip to main content

Table 2 Gene names and abbreviations, primer sequences, amplicon sizes, annealing temperatures, and accession numbers

From: Acute phase protein expressions in secretory and cistern lining epithelium tissues of the dairy cattle mammary gland during chronic mastitis caused by staphylococci

Gene name Gene abbr. Primer sequence Amplicon size [bp] Annealing temp [°C] GenBank accession number
Serum amyloid A3 SAA3 CTCAAGGAAGCTGGTCAAGG
CTTCGAATCCTCCCGTACCT
240 58 NM_181016
Ceruloplasmin CP TTCATGCACATGGAATGACTT
TAAAGGCCCAATGAGTCCTG
236 58 NM_001256556.1
Haptoglobin HP TGGTCTCCCAGCATAACCT
AGGGTGGAGAACCACCTTCT
185 58 NM_001040470