Skip to main content

Table 1 Primers and probe for NDRV detection used in this study

From: A TaqMan-based real-time PCR assay for specific detection of novel duck reovirus in China

RT-PCR Oligo Sequence (5′-3′) Length (bp) Positions (Segment)
Realtime Forward primer CCCGGATTCTCGATGAATGGT 21 958–978(S2)
Probe FAM-AACGCCTGTGCACGAGCTGAAC-3′-TAMRAa 22 981–1022(S2)
Reverse primer CGACCCACTGCTGGATACAAG 21 1022–1042(S2)
σC full-length Forward primer ATGGATCGCAACGAGGTGATAC 22 571–592(S1)
Reverse primer CTAGCCCGTGGCGACGGT 18 1519–1536(S1)
σC conventional Forward primer TGAGACGCCTGACTACGATT 20 707–726(S1)
Reverse primer ATGCTTGGAGTGAGACGACT 20 1056–1075(S1)
  1. aFAM, 6-carboxy-fluoresce; TAMRA, 5-Carboxytetramethylrhodamine