Skip to main content

Table 3 Primer sequences for qPCR assay, amplicon size, PCR efficiencies, and GenBank accession numbers for the genes used in this study

From: Effects of crowding on the three main proteolytic mechanisms of skeletal muscle in rainbow trout (Oncorhynchus mykiss)

Gene Sequence 5′ - 3’ TM (°C) % E GenBank code
40S ribosomal protein S30 (fau) Forward CATTTAGGAGTTGGCGTTGG 60 100% SRX612429
Reverse CCAAGGTTGAAAAGCAGGAG
β-actin Forward GCCGGCCGCGACCTCACAGACTAC 65 103.6% KC888023.1
Reverse GCCGGCCGCGACCTCACAGACTAC
glucocorticoid receptor 1 (gr1) Forward Teles et al. 2013 [45] 58 101.2% Z54210.1
Reverse  
glucocorticoid receptor 2 (gr2) Forward Teles et al. 2013 [45] 63 99.7% AY495372.1
Reverse  
mineralocorticoid receptor (mr) Forward Teles et al. 2013 [45] 63 102.6% AF209873.1
Reverse  
heat-shock protein 70 (hsp70) Forward CATCGGTGAGTTCAAGCGTA 60 98.30% PRJNA518130
Reverse GCCCTGGTAATGGAGGTGTA
regulated in development and DNA damage response 1 (redd1) Forward GGGGGAGGTGTGTCAGAGTA 61 103.5% XM_021615231
Reverse TTACGGGACTGGATGGAGAC
krüppel-like factor 15 (klf15) Forward GGAGAGGAGGAAGAGGAGG 60 101.1% XM_021609837.1
Reverse TGTTCAATGGAGCTGGAAGG
F-box protein 32 (atrogin1) Forward GAATCTGCGGCTGTCTGTT 61 99.8% NM_001195177.1
Reverse CCTCCTGTTGTCCTTGATGG
muscle RING finger 1 (murf1) Forward CAAGAGCATCGAGGAGAACAG 61 97.40% NC_035094.1
Reverse TCCTCTGTCACCACATCATCA
calpain 1 (capn1) Forward TCCTTTTGGAAGCCATTTT 56 104.6% AY573919.1
Reverse GGATATTGTGGGGGTTTT
calpain 2 (capn2) Forward GAAGGACAAGGATTTGGACG 60 101.8% AY573920.1
Reverse CCTGACAGAGCCTCATAGC
calpastatin L (cast-l) Forward CTCAGTAGCCGTGACAA 56 102.2% AY937407.1
Reverse GCTCTTGCCATCCTTATT
calpastatin S (cast-s) Forward GATGGGGGAGAGAGATGTCA 62 100% AY937408.1
Reverse ACTGGGCTGTGTCTGCTT