Skip to main content

Table 2 Primer sequence used for gene expression analysis

From: Thymol modulates the endocannabinoid system and gut chemosensing of weaning pigs

Gene Primer sequence (F and R) 5′ → 3′ Product length (bp) Accession N. Reference
CB1 F: TTCCCCACTTCTTTTCCGCC R: GGGAGTCCCTTCGCATCC 208 XM_013992672.2 Present study
CB2 F: TTTATAGCCTGGCCTCCCCT R: TTTTCCCGTCTGCCTCTGTC 240 XM_021095530.1 [50]
FAAH F: TGCCACCGTGCAAGAAAATG R: CCACTGCCCTAACAACGACT 234 XM_013999418.2 [50]
DGL-α F: GAAACCAAACACGCCTCCAC R: CAACCCAGCAGCAAAGGAAC 211 XM_021082924.1 [50]
DGL-β F: TTTGTAATCCCGGACCACGG R: GACCTGCCGAGGAATACGGA 255 XM_021086077.1 Present study
TRPV1 F: TCACCAACAAGAAGGGGCTC R: GGATAGGTGCCTGCACTCAG 116 XM_005669121.1 [51]
OR1G1 F: CTTGGTTTGTGTGCTCTGCC R: GAAAAGGCTTTCCGCTTCCC 96 XM_013990010.1 Present study
INF-γ F: GGCCATTCAAAGGAGCATGGATGT R: TGAGTTCACTGATGGCTTTGCGCT 149 NM_213948.1 [52]
TNF-α F: GCCCACGTTGTAGCCAATGTCAAA R: GTTGTCTTTCAGCTTCACGCCGTT 99 NM_214022.1 [52]
RPL35 F: AACCAGACCCAGAAAGAGAAC R: TTCCGCTGCTGCTTCTTG 146 NM_214326.2 [53]
  1. F forward, R reverse, CB1 cannabinoid receptor 1, CB2 cannabinoid receptor 2, FAAH fatty acid amide hydrolase, DGL-α diacylglycerol lipase alpha, DGL-β diacylglycerol lipase beta, TRPV1 transient receptor potential vanilloid 1, OR1G1 olfactory receptor 1G1, IFN-γ interferon-γ, TNF-α tumor necrosis factor-α, RPL35 ribosomal protein L35.