Skip to main content

Table 3 Primer pairs used to amplify the partial M and full-length S genes

From: First report and genetic characterization of bovine torovirus in diarrhoeic calves in China

Primer Name Sequence (5-3) Position Size (bp)
MF TTCTTACTACACTTTTTGGA M gene 98–117 603
MR ACTCAAACTTAACACTAGAC M gene 681–700  
S1F ATGTTTTTATGTCTCTGTACCGCG S gene1–24 1481
S1R GCTGCAGCAATAGACCACATAGAC S gene 1458–1481  
S2F AGAATTGAACAACAGACTGGTGAC S gene 1351–1374 1247
S2R GGCACTTCATCAATTGGTACAT S gene 2576–2597  
S3F CCATCTGGTTGTCCTGTCCG S gene 2464–2483 1433
S3R ATGCACCATAGCATCAGTCAC S gene 3877–3897  
S4F AACCAATTTTTTCAGAGCGTGAG S gene 3827–3849 929
S4R CTAGCTTTTCTTAACCTTGC S gene 4736–4755