Skip to main content

Table 1 Primer sequences and product size

From: The correlated expression of immune and energy metabolism related genes in the response to Salmonella enterica serovar Enteritidis inoculation in chicken

Gene Name Accession No. Sequence (5’-3’) Product size(bp)
β-actin NM_205518 Forward: TGCTGTGTTCCCATCTATCG
Reverse: TTGGTGACAATACCGTGTTCA
150
ATP5E XM_001231374.5 Forward: TTGTTGGGAGTGGAGTGT
Reverse: TCACCATTCACAGAGCAGT
204
ATP5G1 XM_001233602.5 Forward: GGACACGGCAAGTAATAGG
Reverse: CATCAAACAGAAGAGACCCA
190
ATP5G3 NM_001277855.1 Forward: AGGACTGGAGAGGGCAAAT
Reverse: CCATCAGACAGAAGAGACCC
230
ND2 YP_009558653.1 Forward: ACACCTTAGCCATCATCCC
Reverse: ATCAGGCGTTGGTTATGC
198
TLR1LA NM_001007488 Forward: GCTTGACTTTAGTGCCTTCATGTTT
Reverse: GCAAGCAATTGGCAGTAAGCT
142
BCL10 NM_001201487 Forward: GGACTGGATGCTTTGGTTGA
Reverse: GAAGGGAGACAGACATAAAT
237
IL-1β XM_015297469.1 Forward: AGAAGAAGCCTCGCCTGGAT
Reverse: CCTCCGCAGCAGTTTGGT
131
IL-8 NM_205498.1 Forward: GGCTTGCTAGGGGAAATGA
Reverse: AGCTGACTCTGACTAGGAAACTGT
200
IL-18 XM_015297946.2 Forward: GCTTCGGTTTTCACTGGTTCTC
Reverse: ACACTCTGTCTGAGGTGCCAAA
117