Skip to main content

Table 3 Primer sequences used for tick and Bartonella spp. identification

From: Molecular detection of Bartonella in ixodid ticks collected from yaks and plateau pikas (Ochotona curzoniae) in Shiqu County, China

Target gene Primer sequence(5′-3′) Product (bp) References
16S rRNA 16S + 1: CTGCTCAATGATTTTTTAAATTGCGG
16S-1: CCGGTCTGACAGATCAAGT
460 [41]
gltA bart781: ATGGCGAATATTTCTCCAAAA
bart1137: AGTGCAGCATTCGCTCCCCCT
379 [42]
rpoB rpoF: GCACGATTYGCATCATCATTTTCC
rpoR: CGCATTATGGTCGTATTTGTCC
379 [43]