Skip to main content

Table 3 Sequences of the oligonucleotide primer used for quantitative real-time PCR

From: Tea polyphenols attenuate liver inflammation by modulating obesity-related genes and down-regulating COX-2 and iNOS expression in high fat-fed dogs

Genes Primer F Primer R
IL-1β TGAAGTGCTGCTGCCAAG GGAAGAGAATTCCATGGT
IL-6 ACCAGGAACGAAAGAGAG GGAATGCCCATGAACTAC
TNF-α CTTCTCCTTCCTCCTCGT AGCCCTTAATTCTCTTTC
GAPDH GGAGAAAGCTGCCAAATATG ACCAGGAAATGAGCTTGACA