Skip to main content

Table 1 Genes selected for MLST scheme and virulence analysis, with their respective primers designed from access to categorized genes of U. diversum ATCC 49782. F indicates forward and R indicates reverse

From: Multilocus sequence typing characterizes diversity of Ureaplasma diversum strains, and intra-species variability induces different immune response profiles

GenePrimerPrimer Sequence 5′ – 3’Gene lengthAmplicon
MLST scheme
ftsHftsH - FCAGTGCGTGATAACAAAACTG1533 bp753 bp
ftsH - RCAACTACATCAGCTTCTTCAGC
polCpolC – FACGGATCTCAGGTTTATCTCAT4305 bp653 bp
polC – RCAGGAAGCATTGTAAAAGGTG
rpL22rpL22 – FCTCAGCAGTTGCTAATGTAACT972 bp809 bp
rpL22 – RAGTATTGGAACCCACTTGG
rpoBrpoB – FAGCCGTATGAACATTGGAC4281 bp718 bp
rpoB – RACTTGAATGATTCAGGCATTCC
ureAureA – FCGACCTTGCTCGTAGACGT306 bp248 bp
ureA – RAGATAGGTTCGTGAATTGACAC
valSvalS – FTGCTCCTTGTATTAGTGAAGAC2616 bp468 bp
valS – RGCTGGGGCTTTAGATGTAAA
Virulence genes
pldpld – FCCAACTGAAGAGTTGATTGTAGC615 bp396 bp
pld – RGGTTTCAACAACCTGTCTTGCG
tgltgl – FATTGCTTGTATGCTTGCGGAAG873 bp546 bp
tgl – RATCACCCTCTGATTCTTCAACT
hlyAhlyA – FGGAGTTGTTCGTTATGTTGGA1389 bp463 bp
hlyA – RCAACAAGCCGACTAAATCCAGT
mibmib – FGATACACCGATTGAACCTCCA2484 bp924 bp
mib – RTCAACCAGGATAACTTCCTTGA
mipmip – FACGAATTTGAAGGTAAGGTAGC2400 bp539 bp
mip – RTCAACTTGCTTGTTGACCAGG
mbamba – FGTTGGTGCTATTATGGCAGGG1398 bp704 bp
mba – RCCATTGTTTGGACTAGGAGTT
VsAVsA – FAACCTAATCTTGGTTCTGACC1227 bp255 bp
VsA – RCTTCGCTTCCTGAACCTTCCAT
tABCtABC – FCGCTTTATTTGCTGCGGTATTA936 bp683 bp
tABC – RCAAGTGCTAAGAATCCAGCTCC
\