Skip to main content

Table 3 Primers and probes used for real-time PCR

From: Serological and molecular evidence of Brucella species in the rapidly growing pig sector in Kenya

Target Gene targeted Sequences of primers and probes (5′ -3′) Fluorophore/ quencher Reference
Genus Brucella IS711 Forward GGCCTACCGCTGCGAAT
Reverse TTGCGGACAGTCACCATAATG
Probe AAGCCAACACCCGGC
FAM/−MGBNFQ Matero, 2011 [13]
Genus Brucella Bcsp31 Forward GCTCGGTTGCCAATATCAATGC
Reverse GGGTAAAGCGTCGCCAGAAG
Probe AAATCTTCCACCTTGCCCTTGCCATCA
6-FAM/BHQ1 Probert, 2004 [14]
B. abortus IS711 downstream of alkB Forward GCGGCTTTTCTATCACGGTATTC
Reverse CATGCGCTATGATCTGGTTACG
Probe CGCTCATGCTCGCCAGACTTCAATG
JOE/BHQ1
B. melitensis IS711 downstream of BMEI1162 Forward AACAAGCGGCACCCCTAAAA
Reverse CATGCGCTATGATCTGGTTACG
Probe CAGGAGTGTTTCGGCTCAGAATAATCCACA
Texas Red/BHQ2