Skip to main content

Table 2 The primers and probe for conventional PCR and LFD-RPA assay used in this assay

From: Rapid and visual detection of porcine deltacoronavirus by recombinase polymerase amplification combined with a lateral flow dipstick

AssayPrimers and probeSequences 5′-3’Amplicon size (bp)
RPAN-FCGTCGTAAGACCCAGCATCAAGCTCCCAAGCGGAC257
N-RGATTATGCTGTACCCTCGATCGT 
LFD-RPALFD-FCGTCGTAAGACCCAGCATCAAGCTCCCAAGCGGAC257
LFD-RBiotin-GACTGTGATTGAGTAGGAGAAGGTAAGGGTAATTG 
LFD-ProbeFITC-GTCGGCTCTGGAGACACTGAGAAGACGGGT (THF)ATGGCTGATCCTCGCATCA-C3-Spacer