Skip to main content

Table 1 Sequences of Primers

From: Betaine attenuates LPS-induced downregulation of Occludin and Claudin-1 and restores intestinal barrier function

Gene Forward primer (5′–3′) Reverse primer (5′–3′)
GAPDH GAAGGTCGGAGTGAACGGAT CTGGCATTGACTGGGGTCAT
Occludin TTGCCTGGGACGAGGCTATG ATCCCTTTGCTGCTCGTGGA
IL-6 TGGATAAGCTGCAGTCACAG ATTATCCGAATGGCCCTCAG