Skip to main content

Table 1 Sequences of Primers

From: Betaine attenuates LPS-induced downregulation of Occludin and Claudin-1 and restores intestinal barrier function

GeneForward primer (5′–3′)Reverse primer (5′–3′)
GAPDHGAAGGTCGGAGTGAACGGATCTGGCATTGACTGGGGTCAT
OccludinTTGCCTGGGACGAGGCTATGATCCCTTTGCTGCTCGTGGA
IL-6TGGATAAGCTGCAGTCACAGATTATCCGAATGGCCCTCAG
\