Skip to main content

Table 5 Primer sequences, references, and expected amplicon size of target gene analysed in the current study

From: Methicillin-resistant Staphylococcus aureus and glycopeptide-resistant enterococci in fecal samples of birds from South-Eastern Poland

PrimerPrimer sequence (5′–3′)Amplicon size (bp)Reference
MecA1GTAGAAATGACTGAACGTCCGATAA310[24]
MecA2CCAATTCCACATTGTTTCGGTCTAA
MecA3GGGATCATAGCGTCATTATTC527[25]
MecA4AACGATTGTGACACGATAGCC
vanA(+)GGGAAAACGACAATTGC732[18]
vanA(−)GTACAATGCGGCCGTTA
vanB(+)ACGGAATGGGAAGCCGA647[18]
vanB(−)TGCACCCGATTTCGTTC