Skip to main content

Table 2 The primer sequences used for the studied cytokines and reference genes

From: The expression of cytokines in the milk somatic cells, blood leukocytes and serum of goats infected with small ruminant lentivirus

ProteinGenePrimer sequencePositionProduct size (bp)Accession No. from GenBankReference
Interleukin 1 alphaIL-1αF:TGAACGACGCCCTCAATCAA
R: CTTGCCATGTGCACCAGTTT
423-442
789-761
358D63350.1designed
Interleukin 1 betaIL-1βF: GCAGCTGGAGGAAGTAGACC
r: TGGCTTTCTTTAGGGAGAGAGG
585-604
816-795
232D63351.1designed
Interleukin 2IL-2F: ATGTACCAGATACCACTCTTGTCTT
R: TCAAGTCATTGTTGAGTAGAT
22–46
489–469
468AY603404.1(9)
Interleukin 4IL-4F:TAGCTTCTCCTGATAAACTA
R: ATGAGTTATAAATATATAAATA
1–20
535–514
535U34273.1(9)
Interleukin 6IL-6F: TCTTCACAAGCGCCTTCAGT
R: CTGCTTGGGGTGGTGTCATT
11-30
131-112
121D86569.1designed
Interleukin 10IL-10F: CGGCGCTGTCATCGTTTT
R: TCTTGGAGCATATTGAAGACTCTCTTC
364-381
446-420
83DQ837159.1(11)
Interleukin 12IL-12F: CACCAAAGATAAAACCAGCACAGT
R: GTCTTTCCAGAAGCCAGACAATG
180-203
305-283
126AY603407.1(11)
Interleukin 16IL-16F: AAAAGACCTCTGCGGGACTG
R: TCAGGCAACGCCTTGATGAT
101-120
314-295
214AF481158.1designed
Interleukin 18IL-18F: TCCTAAGAAGCTATTGAGCACAGGC
R: ATTTTAATATCTAGTCTGGTTTTG
9-33
628-604
611AY605263.1(33)
Interferon alphaIFN-αF: CACCTTCCAGCTCTTCAGCA
R: GTCAGTGAGCTGCTGATCCA
258-277
354-335
97FJ959074.1designed
Interferon betaIFN-βF: ACAGCAGTTCCGGAAGGAAG
R: TCGGTCGTGTCTCCCATAGT
204-223
416-397
213JX458085.1designed
Interferon gammaIFN-γF: TAGCTAAGGGTGGGCCTCTTTTCTCA
R:TGCAGGCAGGAGAACCATTACATTGA
189–214
573-548
385AY603405.1(9)
Tumor NecrosisFactoralphaTNF-αF: AGAAGGGAGATCGCCTCAGT
R: AGAAGGGGATGAGGAGGGTC
488-507
659-640
172X14828.1designed
Cyclophilin APPIAF:GGATTTATGTGCCAGGGTGGTGA
R: CAAGATGCCAGGACCTGTATG
186-208
305-285
120AY 247029.1(36)
Zeta polypeptideYWHAZF:AGACGGAAGGTGCTGAGAAA
R:CGTTGGGGATCAAGAACTTT
290-309
412-393
122BC102382.1(36)