Skip to main content

Table 4 Primers used in this study

From: Tick-borne pathogens in ticks collected from dogs, Latvia, 2011–2016

Pathogen/target gene Primer Sequence (5′- 3′) Amplicon size, bp a Reference
Borrelia spp./ 16S rRNA 16S1A CTAACGCTGGCAGTGCGTCTTAAGC 724 [42]
16S1B AGCGTCAGTCTTGACCCAGAAGTTC   [42]
16S2A AGTCAAACGGGATGTAGCAATACA 657 [42]
16S2B GGTATTCTTTCTGATATCAACAG   [42]
A. phagocytophilum/ 16S rRNA ge3a CACATGCAAGTCGAACGGATTATTC 932 [43]
ge10r TTCCGTTAAGAAGGATCTAATCTCC   [43]
ge9f AACGGATTATTCTTTATAGCTTGCT 546 [43]
ge2 GGCAGTATTAAAAGCAGCTCCAG   [43]
Rickettsia sp./ gltA VC29 GCGGAAGCCGATTGCTTTAC 1108–1111 This study
CS-1069 GAGGGTCTTCGTGCATTTCTT   [44]
RH314 AAACAGGTTGCTCATCATTC 898–901 [45]
CS-1069 GAGGGTCTTCGTGCATTTCTT   [44]
Babesia spp./ 18S rRNA 5-22F GTTGATCCTGCCAGTAGT 1622–1731 [46]
1661R AACCTTGTTACGACTTCTC   [46]
455-479F GTCTTGTAATTGGAATGATGGTGAC 310–368 [46]
793-772R ATGCCCCCAACCGTTCCTATTA   [46]
  1. a Amplicon size depends on the pathogen genospecies, bp base pairs