Skip to main content

Table 2 PCR conditions for the detection and genotyping of avian respiratory viruses in samples from Pakistan

From: Molecular epidemiology of respiratory viruses in commercial chicken flocks in Pakistan from 2014 through to 2016

Virus Primers Sequences (5–3) Target Amplicon size (bp) PCR conditions Reference
Detection PCR AAVV-1 FIP-1 5′ TACTTTGCTCACCCCCCTT 3’ Fusion gene (F) 280 94 C for 2 min; 40 cycles of 94 C for 30 s, 58 C for 30 s, 72 C for 1 min; final extension at 72 C for 5 min [48]
FIP-2 5’ CATCTTCCCAACTGCCACT 3’
IBV N791 5’ GTGATGACAAGATGAATGAGGA 3’ Nucleo-protein gene (N) 380 94 C for 2 min; 40 cycles of 94 C for 30 s, 54 C for 30 s, 72 C for 1 min; final extension at 72 C for 5 min [49]
N1129 5’ CAGCTGAGGTCAATGCTTTATC 3’
ILTV gEU
gEL
5’ GCTGGGTTCTGGGCTACACAAC 3′
5′ TGCGCGTGACTCGGAGAG 3’
Glyco-protein E gene (gE) 626 94 C for 2 min; 40 cycles of 94 C for 30 s, 61 C for 30 s, 72 C for 1 min; final extension at 72 C for 5 min [50]
aMPV G1a 5′ GGGACAAGTATCYMKAT 3’ Attachment glycoprotein gene (G) 441 94 C for 2 min; 40 cycles of 94 C for 30 s, 50 C for 30 s, 72 C for 1 min; final extension at 72 C for 5 min [51]
G6a 5′ CTGACAAATTGGTCCTGATT 3’
AIV M52C 5′ CTTCTAACCGAGGTCGAAAG 3’ Matrix gene (M) 280 95 C for 30 s; 40 cycles of 95 C for 30 s, 55 C for 30 s, 72 C for 30s; final extension at 72 C for 1 min [52]
M253R 5’AGGGCATTTTGGACAAAKCGTCTA 3’
Genotyping PCR AIV HA-1134F 5′ GGAATGATHGAYGGNTGGTATG 3′ hemma-gglutinin gene (HA) 600 95 C for 30 s; 40 cycles of 95 C for 30 s, 55 C for 30 s, 72 C for 30s; final extension at 72 C for 1 min [53]
NS-890 R 5′ ATATCGTCTCGTATTAGTAGAAAC AAGG 3′
IBV S15 5′ TGAAAACTGAACAAAAGACA 3’ Spike gene (S) 700 95 °C for 2 min; 40 cycles of 95 °C for 30 s, 52 °C for 30 s, 72 °C for 30 s; final extension of 72 °C for 12 min [54]
CK2 5′ CTCGAATTCCNGTRTTRTAYTGRCA 3′
  1. bp base pairs
  2. athis primer pair does not detect serotype C viruses