Skip to main content

Table 3 Primer pairs used in qPCR

From: Characterization of five newly derived canine osteosarcoma cell lines

Primer Sequence 5′ to 3’
Canine forward AGGGCGCGATCCTGGAGAC
Canine reverse AGACACAGGCAGAGGGAGAA