Skip to main content

Table 8 Primer information of target and reference genes

From: Effects of postbiotic supplementation on growth performance, ruminal fermentation and microbial profile, blood metabolite and GHR, IGF-1 and MCT-1 gene expression in post-weaning lambs

Target gene Primer Sequence (5′ - 3′) Product size (bp) NCBI accession number
GHR F - GCCAAAACAATAAGACTGGGAACC
R - GGCTGTAGTGGTAAGGCTTTCTGTG
218 XM_012096676.1
IGF-1 F - ATTACAGCTGCCTGCCCCTT
R - CACATCTGCTTACACCTTACCCG
265 NM_001009774.3
MCT-1 F - TGGCATCTTATCAGGCAGTGG
R - CCAGCCACACAGCAGTTTAATAG
300 XM_004002335.3
GADPH F - ACCACTTTGGCATCGTGGAG
R - GGGCCATCCACAGTCTTCTG
76 NM_001190390.1
  1. F Forward, R Reverse, GHR Growth hormone receptor, IGF-1 Insulin-like growth factor 1, MCT-1 Monocarboxylate transporter 1, GADPH Glyceraldehyde 3-phosphate dehydrogenase