Skip to main content

Table 7 Sequence of polymerase chain reaction primers used to target microbes

From: Effects of postbiotic supplementation on growth performance, ruminal fermentation and microbial profile, blood metabolite and GHR, IGF-1 and MCT-1 gene expression in post-weaning lambs

Target microbes Primer References
Total bacteria F - CGGCAACGAGCGCAACCC
R - CCATTGTAGCACGTGTGTTAGCC
[53]
F. succinogenes F - GTTCGGAATTACTGGGCGTAAA
R - CGCCTGCCCCTGAACTATC
[54]
R. albus F - CCCTAAAAGCAGTCTTAGTTCG
R - CCTCCTTGCGGTTAGAACA
[55]
R. flavefaciens F - TCTGGAAACGGATGGTA
R - CCTTTAAGACAGGAGTTTACAA
[55]
Methanogens F - TTCGGTGGATCDCARAGRGC
R - GBARGTCGWAWCCGTAGAATC
[56]
Protozoa F - CTTGCCCTCYAATCGTWCT
R - GCTTTCGWTGGTAGTGTATT
[57]
  1. F Forward, R Reverse